[Investigation of Anisakis infections in coastal marine fishes and awareness of anisakiasis control knowledge among residents in Yantai City in 2021].

OBJECTIVE: To investigate the prevalence of Anisakis infections in coastal marine fishes and awareness of anisakiasis control knowledge among local residents in Yantai City, Shandong Province in 2021, so as to provide insights into formulation of anisakiasis control interventions. METHODS: Marine fishes were purchased from Shunxin Port, Yantai City, Shandong Province in November 2021, and the presence of Anisakis was detected in different species of fishes and different fish sites. The correlations between body length and weight of marine fish and intensity of Anisakis infections were examined using Spearman's rank correlation analysis, and the dietary habits and anisakiasis control knowledge were investigated using questionnaire surveys among local residents. RESULTS: A total of 201 marine fishes belonging to 20 species were dissected, and Anisakis was detected in 77 marine fishes (38.31%) belonging to 11 species (55.00%), with a mean infection intensity of 45.04 parasites per fish (3 468/77). Spearman's rank correlation analysis revealed that the body length (rs = 0.74, P < 0.05) and weight (rs = 0.79, P < 0.01) of the monkfish correlated positively with the intensity of Anisakis infections, and the body length (rs = 0.68, P < 0.05) of the flatfish correlated positively with the intensity of Anisakis infections, while no correlations were examined between the body length or weight of other marine fishes and the intensity of Anisakis infections. Of all respondents, 53.38% men and 56.67% women did not know anisakiasis control knowledge at all, and there was a significant difference in the proportion of respondents using separate chopping boards for raw and cooked food from different villages (χ2 = 17.89, P < 0.01), while there was an age-specific proportion of respondents with habitats of eating raw or semi-raw seafood (χ2 = 28.27, P < 0.01). CONCLUSIONS: The prevalence and intensity of Anisakis infections were high in coastal marine fishes in Yantai City in 2021, and the awareness of anisakiasis control knowledge was low among local residents. Intensified health education pertaining to anisakiasis control knowledge is recommended to reduce the risk of Anisakis infections.

Methods for inactivation of seafood Anisakis larvae and prevention of human anisakiasis: a mini-review.

Anisakiasis is an arising zoonosis induced by parasitic nematodes belonging to the family Anisakidae. Anisakiasis is often caused by the ingestion of larval nematodes in uncooked or minimally processed seafood dishes, which are regularly consumed by humans. Significant potential sources of infection are raw fish (e.g., sushi and sashimi) that can be found in traditional Japanese cuisine and can be part of the culinary tradition of consumption of raw or marinated fish that is particularly diffused in European countries. During the last five decades, the global prevalence of human anisakiasis has been rising, becoming an emergent major public health problem. Thus, there is an unmet need for well-defined and cost-effective methods aimed at killing Anisakis larvae, thus reducing the incidence of anisakiasis. In this mini-review, we discuss the clinical features of anisakiasis as well as the effectiveness and mechanisms of action of the main methods employed for increasing seafood safety and killing Anisakis larvae, including freezing, heating, use of high hydrostatic pressure, salting process, pepsin digestion method and use of garlic oil.

[Human diseases caused by Anisakis simplex]. / Maladies causées par Anisakis simplex chez l'humain.

Anisakis simplex is a parasitic worm. It infects marine mammals that feed on fish and cephalopods, its intermediary hosts. Human disease is caused by accidental ingestion of Anisakis larvae. Upon consumption of contaminated fish, cuttlefish or squid, human may develop two distinct clinical pictures: Anisakiasis is provoked by living larvae penetrating the digestive mucosa. Allergy is caused by IgE-mediate hypersensitivity to living or dead larvae in a previously sensitized individual. Anisakiasis may manifests with violent epi gastric pain, acute abdomen or eosinophilic gastroenteritis. The larvae may be visualized by endoscopy or histology. The main Anisakis allergens are not denaturated by heat or cold and resist to digestion. Allergy diagnosis relies on careful history and detection of specific IgE.

Anisakis simplex est un ver parasite (helminthe) du groupe des nématodes. Il infeste les mammifères marins se nourrissant de poissons et de céphalopodes, ses hôtes intermédiaires. Chez l'homme, l'ingestion de poissons, de calamars ou de seiches contaminés est responsable de 2 tableaux cliniques. L'anisakiase est provoquée par la pénétration de la muqueuse digestive par des larves vivantes. L'allergie est une réaction IgE (immunoglobuline E) médiée aux parasites morts ou vivants chez une personne préalablement sensibilisée. L'anisakiase occasionne des épigastralgies, un abdomen aigu ou de manière plus sournoise une gastroentérite à éosinophiles. Les larves sont visualisables par endoscopie ou à l'histologie. Les principaux allergènes d'Anisakis résistent à la cuisson et à la digestion. Le diagnostic d'allergie se base sur l'anamnèse et la détection d'IgE spécifiques.

Anisakiasis in Palatine Tonsil.

ABSTRACT: Anisakiasis is a parasitic infection caused by ingesting raw or undercooked fish and seafood infected with Anisakis larvae. Anisakis genus is mostly found in the mucosal or submucosal layer of the stomach and intestine. However, the reports of anisakiasis in tonsils are highly uncommon. A 54-year-old woman with clinical features of sore throat and foreign-body sensation for 10 days after eating raw and undercooked fish. A wriggling worm was noted beneath the mucosa of the right palatine tonsil upon endoscopic examination. The worm was immediately removed completely and histological examination revealed anisakiasis. Reports of anisakia-sis in the tonsils are scarce, but it should be considered at the initial physical examination of patients who visit the hospital for sore throat after eating raw fish. We report a case of anisakiasis in the palatine tonsils, which to date has been rarely reported in the literature.

Sensitivity of candling as routine method for the detection and recovery of ascaridoids in commercial fish fillets.

Ascaridoids are one of the main parasitic hazards in commercial fish. Candling is the current industrial screening method whereby visible ascaridoid larvae are detected on a light table and manually removed. The aim of this study was to assess the sensitivity (Se) and negative predictive value (NPV) of this method. To make targeted recommendations to the fish industry, the Se was calculated per fish part, larval genus, and fish species. All fish parts (n = 615) were first candled, and larvae were collected, followed by enzymatic digestion to recover the remaining larvae. A fish part was considered positive if at least one larva was detected using candling and/or enzymatic digestion, with both methods combined as reference standard. The overall Se of candling was 31% (95% CI 23-41%) and NPV was 87% (95% CI 85-90%). The Se increased with higher numbers of larvae/100 g infected muscle. A low NPV was found for the belly flaps, therefore we either advise the removal or proper freezing of this part. Lastly, the Se and larval recovery was the highest for the darker and larger Pseudoterranova spp. larvae. Due to the low overall efficacy of candling, further assessment of its cost-benefit and impact on consumers' health risk should be conducted.

Evaluation of real-time qPCR-based methods to detect the DNA of the three protozoan parasites Cryptosporidium parvum, Giardia duodenalis and Toxoplasma gondii in the tissue and hemolymph of blue mussels (M. edulis).

The protozoan parasites Cryptosporidium spp., Giardia duodenalis and Toxoplasma gondii can be transmitted to humans through shellfish consumption. No standardized methods are available for their detection in these foods, and the performance of the applied methods are rarely described in occurrence studies. Through spiking experiments, we characterized different performance criteria (e.g. sensitivity, estimated limit of detection (eLD95METH), parasite DNA recovery rates (DNA-RR)) of real-time qPCR based-methods for the detection of the three protozoa in mussel's tissues and hemolymph. Digestion of mussels tissues by trypsin instead of pepsin and the use of large buffer volumes was the most efficient for processing 50g-sample. Trypsin digestion followed by lipids removal and DNA extraction by thermal shocks and a BOOM-based technique performed poorly (e.g. eLD95METH from 30 to >3000 parasites/g). But trypsin digestion and direct DNA extraction by bead-beating and FastPrep homogenizer achieved higher performance (e.g. eLD95METH: 4-400 parasites/g, DNA-RR: 19-80%). Direct DNA recovery from concentrated hemolymph, by thermal shocks and cell lysis products removal was not efficient to sensitively detect the protozoa (e.g. eLD95METH: 10-1000 parasites/ml, DNA-RR ≤ 24%). The bead-beating DNA extraction based method is a rapid and simple approach to sensitively detect the three protozoa in mussels using tissues, that can be standardized to different food matrices. However, quantification in mussels remains an issue.

A case report and statewide surveillance of "weak meat" condition of Alaska weathervane scallops, Patinopecten caurinus, linked to a recently identified pathogenic parasite, Merocystis kathae (Apicomplexa: Aggregatidae).

Weathervane scallop, Patinopecten caurinus, the largest scallop species in the world, is distributed from northern California, U.S.A., to the Bering Sea, and is only commercially harvested in Alaska. The fishery is considered well managed by the State of Alaska (U.S.A) Department of Fish and Game (ADF&G) and federal government, with many precautionary measures in place to avoid overharvest. There have been episodic declines in some management areas due to unknown causes. Fishermen also encounter scallops with abnormal adductor muscles, a condition colloquially termed "weak meat", characterized by the retention of muscle when shucked, an obvious darkened discoloration, and/or an abnormal texture making the product unacceptable for marketing. A similar syndrome in Atlantic sea scallops, Placopecten magellanicus, described as "gray meat", occurs in the eastern U.S. and Canada, and proposed causes include senescence, loss of bioenergetics due to chronic infestations, or a synergism of these factors. Recently a severe apicomplexan infection was found to cause a gray meat condition in Iceland scallops, Chlamys islandica, and the collapse of that stock. This parasite was subsequently detected in Atlantic sea scallops with the gray meat condition off the U.S. East Coast. Studies that followed identified the parasite as Merocystis kathae, previously described from the common whelk, Buccinum undatum, more than 100 years ago. In 2015 Bering Sea fishermen reported weak meat in their catch, so samples were submitted to ADF&G for diagnosis. Adductor muscles from all affected scallops had many large foci of an apicomplexan associated with necrosis, fibrosis, and muscular atrophy. Given the reduced quality, marketability, and possibly fitness of affected scallops, we performed a survey to estimate prevalence, intensity, and geographic distribution of this apicomplexan in Alaskan weathervane scallops. We sampled 180 scallops, from individual beds within each of the three major geographically broad scallop areas in Alaska. Overall prevalence was about 82%, ranging from 69 to 100% by district. Overall mean infection intensity, based on the number of parasite foci/section, was about 9 (range of 5-29, by location), with scallops from the Bering Sea and Southwest Kodiak being most severely infected. Molecular analyses confirmed that the Alaskan parasite is M. kathae, i.e., the same apicomplexan that caused the collapse of Icelandic scallops and a suspected cause for gray meat and mass mortality of Atlantic sea scallops in northeast North America.

First report of Kudoa thunni and Kudoa musculoliquefaciens affecting the quality of commercially harvested yellowfin tuna and broadbill swordfish in Eastern Australia.

Recent anecdotal reports from seafood processors in eastern Australia have described an increased occurrence of post-mortem myoliquefaction ('jellymeat') in broadbill swordfish Xiphias gladius, and macroscopic cysts throughout the musculature of yellowfin tuna Thunnus albacares. A genus of parasitic cnidarians, Kudoa (Myxosporea, Multivalvulida), species of which are known to occur in economically important wild-caught fish species globally, can cause similar quality-deterioration issues. However, Kudoa sp. epizootiology within commercially harvested, high-value fish caught within Australia is poorly understood, despite the parasite's economic importance. To determine the causative agent responsible for the observed quality deterioration in swordfish and yellowfin tuna, muscle-tissue samples from seafood processors in Mooloolaba, Australia, collected from October 2019-February 2020, were examined for parasitic infection. Kudoid myxospores were identified from both hosts and were subquadrate in shape, with four equal-sized polar capsules. The SSU rDNA sequences from both fish shared > 99% identity to Kudoa species. Kudoa musculoliquefaciens was isolated from 87.1% of swordfish sampled, suggesting that it is a widespread parasite in swordfish from the southwest Pacific Ocean. This study provides the first molecular and morphological characterisation of Kudoa thunni in yellowfin tuna and K. musculoliquefaciens in swordfish harvested from the waters of eastern Australia, expanding the geographical distribution of K. thunni and K. musculoliquefaciens to include the Coral and Tasman Seas. We demonstrate that not all infected swordfish progress to jellymeat, show the usefulness of molecular tools for reliably identifying infection by Kudoa spp., and add to the overall knowledge of kudoid epizootiology in wild-caught fish.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Integrative species delimitation and community structure of nematodes in three species of Australian flathead fishes (Scorpaeniformes: Platycephalidae).

This study aimed to determine the integrative characterisation of nematodes from three species of edible flathead fishes (Scorpaeniformes: Platycephalidae) in New South Wales, Australia, and describe nematode communities within three species of flatheads. Tiger (Platycephalus richardsoni (Castelnau); n = 20) and sand flatheads (Platycephalus bassensis (Cuvier); n = 20), sourced from the Nelson Bay area, and dusky flathead (Platycephalus fuscus (Cuvier); n = 20) from the Manning River, Taree, were examined for the presence of nematodes. The nematodes were initially classified morphologically as 12 different morphotypes belonging to the families Anisakidae (Anisakis types I, II, and III, Contracaecum type II, Terranova types I and II), Raphidascarididae (Hysterothylacium types IV, VI, VIII, and H. zhoushanense larva), and Gnathostomatidae (Echinocephalus sp. larva), Capillariidae (Capillaria sp.), followed by genetic identification through sequencing of the internal transcribed spacer (ITS-1, 5.8S, ITS-2) regions. Phylogenetic analyses revealed the evolutionary relationship between the identified larval specimens in the present study with available GenBank larval and adult nematodes. Sand flathead was 90% infected with nematodes followed by tiger flathead at 85% and dusky flathead at 15%. Nematodes infecting estuarine dusky and oceanic sand and tiger flatheads contrasted markedly. The analysis of similarities (ANOSIM) showed significant differences (p < 0.001) in the composition of taxa within nematode communities between the three species of flatheads (global R = 0.208) with the highest difference being between sand and dusky flatheads (R = 0.308, p < 0.001). The findings of the present study provide a foundation for future investigations of the community composition, life cycles, and distribution of nematode populations in edible fish in Australia and explore and clarify their significance to public health.

Unexpected morphological and molecular diversity of trematode (Haploporidae: Forticulcitinae) parasites of mullets from the ocean Pacific coasts in Middle America.

Two new genera and four new species from subfamily Forticulcitinae are described from the intestines of white mullet (Mugil curema) and flathead grey mullet (Mugil cephalus) collected in 27 localities across a wide geographical range on Pacific Ocean slopes comprising three countries in Middle America: Mexico, Guatemala and Costa Rica. The new genera Ekuarhuni n. gen. and Overstreetoides n. gen. had to be erected to accommodate two new species, Ekuarhuni papillatum n. sp. and Overstreetoides pacificus n. sp., with unique morphological traits that differentiate them from the two genera described previously. In addition, two new species, Forticulcita minuta n. sp. and Forticulcita isabelae n. sp., were described, which were characterized as exhibiting a small body size (< 1100 µm long). These new species were classified as the diminutive morphotype, together with three other congeneric species of Forticulcita. Forticulcita minuta n. sp. is distinguished by being the smallest species within the genus (< 305 µm). Meanwhile, Forticulcita isabelae n. sp. is distinguished by its body size and testis length. In specimens of the four new species, sequencing was performed with two molecular markers, the large subunit (LSU) and the internal transcribed spacer 2 (ITS2) of nuclear rDNA, and the results were compared with other sequences available in GenBank. Phylogenetic analyses performed with the combined dataset of the two nuclear molecular markers (LSU + ITS2) placed all the analysed species within the clade of Forticulcitinae with strong bootstrap support (100%) and a high Bayesian posterior probability (1.0). The four new species showed differences in abundance in their definitive hosts and were widely distributed along the Pacific Ocean coasts of Mexico, Guatemala and Costa Rica, in Middle America.

The presence of Apicomplexan parasites in king scallops (Pecten maximus) in Scottish waters.

The king scallop (Pecten maximus) is a commercially important species found around the United Kingdom coast. The association of an Apicomplexan-like parasite with mass mortality of Icelandic scallop (Chlamys islandica) in Iceland and the presence of identical parasites in king scallop (Pecten maximus) and queen scallop (Aequipecten opercularis) in Scotland raised serious concerns regarding the health of Scottish king scallops. Marine Scotland Science (MSS) conducted a survey in 2016 to assess the prevalence and the intensity of parasite infection in king scallops. King scallops were collected and sampled during the annual scallop dredge surveys in the Shetland Isles and the east and west coast of Scotland. The king scallop adductor muscle was macroscopically examined and tissue imprints taken to grade the intensity of infection. The parasite was present in the majority of the king scallops sampled in all surveyed areas: Shetland Isles 87.1%, east coast 76.0% and west coast of Scotland 64.1%. However, the parasitic infestations were light in intensity with the majority of the king scallops graded as 1 (≤20 zoites per microscopic field). No macroscopic changes in the adductor muscle were observed and histopathology examination revealed minor localized fiber degeneration of adjacent fibers to parasite clusters. The results suggested the parasite to be widespread around the Scottish coast and it appears to be able to live within the king scallop at low intensity of infection without causing significant downgrade of the adductor muscle (in terms of colour or texture) or mortality. The partial genome sequence of the parasite in king scallops from Scottish waters was identical to the one reported by Kristmundsson and Freeman (2018) in the Icelandic scallop in Icelandic waters.

Anisakis simplex (s.s.) larvae (Nematoda: Anisakidae) hidden in the mantle of European flying squid Todarodes sagittatus (Cephalopoda: Ommastrephidae) in NE Atlantic Ocean: Food safety implications.

Few reports exist upon the occurrence and localization of zoonotic anisakid nematodes in T. sagittatus, especially in the mantle of the squid. The occurrence and site of infection of larval anisakids in 98 T. sagittatus caught West off St. Kilda, NE Atlantic Ocean, were investigated. Squids were examined for anisakids using the UV-Press method. In total, 689 nematodes were detected in the viscera and mantle. According to morphology, all the larvae (L3) were assigned to genus Anisakis. Diagnostic allozymes and mtDNA cox2 sequence analysis permitted to genetically identify all larvae as Anisakis simplex (s.s.) (N = 100). Overall prevalence (P = 81%) and mean intensity (mI = 8.6) of infection with A. simplex are provided. Most of the larvae present in the mantle cavity were embedded in the stomach wall or attached in the outer layer of the stomach and caecum (49%). Over a third of squids (37%) hosted A. simplex (s.s.) larvae in the mantle. A novel schematized representation of larvae distribution in the mantle is provided, showing where they were mostly located. According to the results obtained, the risk of anisakiasis associated with consumption of raw or undercooked T. sagittatus should be considered.

Zschokkella epinepheli n. sp. (Myxosporea: Myxidiidae) infecting the gallbladder of the white grouper Epinephelus aeneus (Serranidae) from Tunisian waters.

A new coelozoic myxosporean species, Zschokkella epinepheli n. sp., collected from the gallbladder of the white grouper Epinephelus aeneus (Perciformes: Serranidae) from the bay of Bizerte, Tunisia, is described based on morphological and molecular characteristics. Myxospores and plasmodia were observed floating free in the bile. Mature plasmodia were polysporic and subspherical in shape, measuring 85.0-94.0 µm long and 70.0-82.0 µm wide. Mature myxospores were ovoid in valvular view, measuring 10.0 ± 1.7 (8.0-11.0) µm in length and 7.0 ± 0.3 (6.6-7.5) µm in width. Polar capsules were pyriform and equal in size, measuring 3.0 ± 0.2 (2.8-3.6) µm in length and 2.3 ± 0.3 (1.8-2.7) µm in width. Myxospore valves had 12-14 longitudinal striations. Based on the small subunit rDNA, the new species Z. epinepheli n. sp. differs from all other Zschokkella species for which there is a DNA sequence deposited in GenBank. Phylogenetic analysis revealed that Z. epinepheli n. sp. clustered in the marine subclade of Zschokkella species within the biliary tract IV clade. This is the first report of a Zschokkella species from the gallbladder of an epinephelin fishes.

Case Report: Protracted Eosinophilic Meningitis due to Probable Angiostrongyliasis.

Eosinophilic meningitis is classically caused by Angiostrongylus cantonensis. Treatment usually includes supportive care and corticosteroids. Anthelminthic drugs are often avoided because of the risk of an inflammatory reaction to dying larvae. The duration of symptoms in most cases is up to a few weeks. We describe a case of eosinophilic meningitis, likely due to Angiostrongylus spp. infection, with recurrent symptoms and persistent cerebrospinal fluid eosinophilia despite corticosteroid treatment, over a period of almost 5 months. This only resolved after treatment with albendazole.

World-wide prevalence of Anisakis larvae in fish and its relationship to human allergic anisakiasis: a systematic review.

The infective stage of Anisakidae nematodes responsible for allergic reactions in humans is found in a variety of edible fish and cephalopods. The identification of geographical regions that are high risk for infected seafood may help prevent allergic reactions in humans. Despite an abundance of published literature which has identified anisakid larvae in an array of edible seafood as well as scattered reports of human allergic anisakiasis, the relationship between the two has not been fully explored. Therefore, a systematic spatio-temporal study was conducted to determine the prevalence of Anisakis spp. in fish from January 2000 to August 2020 firstly to explore the relationship between fish infection and cases of allergic anisakiasis and secondly to use fish infection data to map potential allergic anisakiasis 'hot spots'. A systematic literature search for original English text articles was conducted through search engines, Web of Science, Scopus, PubMed, Science Direct and Google Scholar. Out of 3228 articles which describe anisakid infection in fish, 264 were used for data extraction. Of 904 articles describing allergic anisakiasis, 37 were used for data extraction. A qualitative summary of the extracted data was performed using equal interval method (ArcMap software) in order to compare the global distribution of Anisakis-infected fish. Of the 152-identified fish hosts, five families were most commonly infected with Anisakis spp. These included Lophiidae (86.9%), Trichiuridae (77.05%), Zeidae (70.9%), Merlucciidae (67.8%) and Gadidae (56.8%). The hot spot areas for allergic anisakiasis were North and northeast of Atlantic Ocean, southwest of USA, west of Mexico, south of Chile, east of Argentina, Norway, UK and west of Iceland (confidence 99%). The highest rate of allergic anisakiasis was in Portugal and Norway with the prevalence rate of 18.45-22.50%. Allergologists should consider allergic anisakiasis as a public health issue particularly in high-risk countries where high prevalences in fish have been demonstrated.

Infection and molecular identification of ascaridoid nematodes from the important marine food fish Japanese threadfin bream Nemipterus japonicus (Bloch) (Perciformes: Nemipteridae) in China.

The Japanese threadfin bream N. japonicus (Bloch) (Perciformes: Nemipteridae) is an important marine food fish in Asia. However, our present knowledge of the occurrence of its nematode parasites is still limited. In the present study, the species composition and infection rate of ascaridoid nematodes in N. japonicus from the South China Sea, were studied for the first time. Five ascaridoid species, namely Anisakis typica (L3), Hysterothylacium amoyense (L3), Hysterothylacium sp. IV-A (L3), adult of H. thalassini and Raphidascaris lophii (L3), were identified using integrative taxonomy. Hysterothylacium amoyense was the most prevalent species (prevalence 47.2%, mean intensity 14.9 ± 17.1). Hysterothylacium thalassini and R. lophii were reported in the Japanese threadfin bream for the first time. Two different genotypes of A. typica (overall prevalence of 3.4%; mean intensity 1.7 ± 0.9) were found in the South China Sea for the first time. The unique restriction polymorphism patterns of three species of Hysterothylacium are provided for rapid diagnosis. Our present results indicate that RFLP analysis of ITS region, using the restriction enzymes HhaI and RsaI, represents a simple and practical method for large-scale surveys of Hysterothylacium for seafood industry.

Larval ascaridoid nematodes in horned and musky octopus (Eledone cirrhosa and E. moschata) and longfin inshore squid (Doryteuthis pealeii): Safety and quality implications for cephalopod products sold as fresh on the Italian market.

The aim of this study was to evaluate the occurrence, infection level and distribution of ascaridoid larvae in cephalopod products sold in Italy. Data on the species most commonly commercialized as whole and fresh on the Italian market were collected. After comparing commercial and literature data, Eledone spp., comprising E. cirrhosa and E. moschata (horned octopus and musky octopus, respectively) and Doryteuthis pealeii (longfin inshore squid) were selected, as they had been rarely investigated. Overall, 75 Eledone spp. caught in the Mediterranean Sea (FAO area 37) and 70 D. pealeii from the Northwest Atlantic Ocean (FAO area 21) were examined by visual inspection and artificial digestion (viscera and mantle separately). Parasites were submitted to morphological and molecular analysis. Prevalence (P), mean intensity (MI) and mean abundance (MA) were calculated. In D. pealeii, 2 nematode larvae molecularly identified as Anisakis simplex s.s. were found in the viscera and in the mantle of two specimens (P: 2.9% 95% CI: 0-6.8%; MI: 1; MA: 0.028). In Eledone spp. 9 nematode larvae molecularly attributed to Hysterothylacium spp. were found in the mantle of 5 specimens (P: 6.7% 95% CI: 1-12.3%; MI: 1.8; MA: 0.12). This is the first report of A. simplex s.s. in D. pealeii. Considering the zoonotic and allergenic potential of these larvae and their localization also in the edible part (mantle), a potential public health issue exists.

Investigation of Anisakis larvae in different products of ready-to-eat fish meat and imported frozen fish in Turkey.

Globalization opens new market areas and affects food consumption habits, resulting in rapid and remarkable cultural change. Food habits such as consumption of raw fish meat have become popular, resulting in increased risk of emerging infectious diseases. Anisakis simplex sensu stricto (s.s) and A. pegreffii are the most common and important fish-borne zoonotic nematodes responsible for human anisakiasis, which occurs through the consumption of raw or undercooked fish as well as cooked fish due to their heat-stable allergens. Here, we investigated the prevalence, intensity, and abundance of Anisakis larvae in imported fish and ready-to-eat local fish products in Turkey. A total of 205 ready-to-eat fish products, 100 imported frozen Atlantic salmon (Salmo salar) fillets, and 100 imported frozen whole Atlantic mackerel (Scomber scombrus) were sampled from supermarkets, sushi restaurants, and fish markets. All samples were individually examined using a pepsin digestion technique. In total, 602 Anisakis type I larvae were recovered from 98/100 mackerel. No larvae were found in ready-to-eat products or frozen Atlantic salmon fillets. Overall, 8.8% of the larvae were found in the muscle tissue. The overall mean intensity and abundance of infection in mackerel were 6.14 and 6.02, respectively. The larvae were molecularly identified and their phylogenetic relationships with the relevant Anisakis sequences in GenBank were investigated. For this purpose, a subsample of randomly selected 100 Anisakis larvae were analyzed with PCR-RFLP of the ITS region. The larvae were identified as A. simplex (s.s.) (n = 87) and hybrids (n = 13). ITS and cox2 gene regions of all hybrids and randomly selected 50 A. simplex (s.s.) larvae were sequenced for species confirmation and phylogenetic analyses. No intraspecific nucleotide variation was found among the ITS sequences of either species. Seven and three haplotypes, respectively, were identified for A. simplex (s.s.) and hybrid species according to DNA polymorphism of the cox2 gene. Hybrids in our study clustered within the common A. simplex (s.s.) clade in the cox2 phylogenetic tree indicating the dominance of A. simplex (s.s) in the catching area of Atlantic mackerel. Consequently, our study indicates high occurrence of A. simplex (s.s.) larvae with an overall 98.0% prevalence in imported Atlantic mackerel, and highlights the importance of these fish as potential reservoirs for human allergic anisakiasis in Turkey and possibly in other countries.